last update: 02/27/2007


Search | background | matrices & thresholds | input & output | caveats


Input format

ESEfinder accept sequences in the FASTA format. A sequence in FASTA format begins with a ">" and then a single line description, followed by lines sequence data. Multiple sequences are allowed and each one should have a descriptive line. An example of a FASTA file is given below: 

>seq1
aaatagacaattttaaaaaccaaacagaatgggactgtcttctgcaagcc
tacctacaaacag
>
aaatcagttcgtcttcgttgcagcagatgaaatttcttgtaacacctctg
cag

The query sequences can be directly pasted into the text box, or can be uploaded from a text file

Size limit
To improve performance, the total size of query sequences in a submission is limited to 5000 nucelotides, no matter it is in a single sequence or in multiple sequences.

Output format

ESEfinder 3.0 has made a number changes in the output format.

In the first page, the user can choose to generate output in either html format or plain text format.

In html format, the result of each sequence is displayed separately, each has three sections

  • sequence summary
  • tabular output
  • graphical output

Since release 2.0, ESEfinder allows to direct graphical display of the results

  • the analyzed (exonic) sequence is reproduced along the X-axis.
    Either the actual nucleotides or the nucleotide number can be displayed
  • only the high-score values (the values above the selected threshold) are represented
  • the height of the bars represents the motif scores
  • the width of the bars indicates the length of the motif (6, 7 or 8 nucleotides)
  • the different SR protein high-scores are color-coded as illustrated below
An example
Example input:

>BRCA1 WT
ATGCTGAGTTTGTGTGTGAACGGACACTGAAATATTTTCTAGGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTTCT

Example html output:


seq #1 id: BRCA1 WT

length:78

Sequence

ATGCTGAGTTTGTGTGTGAACGGACACTGAAATATTTTCTAGGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTTCT

Tabular results

SF2/ASF
threshold: 1.956		 SF2/ASF (IgM-BRCA1)
threshold: 1.867		 SC35
threshold: 2.383		 SRp40
threshold: 2.67		 SRp55
threshold: 2.676
Position*/Site/Score Position*/Site/Score Position*/Site/Score Position*/Site/Score Position*/Site/Score
4 (-75) CTGAGTT 2.14295
23 (-56) GACACTG 2.16497
50 (-29) GGGAGGA 3.71421
4 (-75) CTGAGTT 2.60946
21 (-58) CGGACAC 2.11382
50 (-29) GGGAGGA 2.21174
22 (-57) GGACACTG 4.96856
43 (-56) GAATTGCG 2.53029
36 (-43) TTTCTAG 4.15152
11 (-68) TGTGTG 2.82087
13 (-66) TGTGTG 2.82087
47 (-32) TGCGGG 3.55869
60 (-19) TGGGTA 2.70848
* both positions from 5'end (through 1) and 3'end (through -1) are given




Graphical results




  SF2/ASF
  SF2/ASF (IgM-BRCA1)
  SC35
  SRp40
  SRp55


go top


Krainer Lab and Zhang Lab, Cold Spring Harbor Laboratory, all rights reserved
Questions/suggestions email: Jinhua Wang.